chrna5

Ensembl ID:
ENSDARG00000003420
ZFIN ID:
ZDB-GENE-050417-440
Description:
neuronal acetylcholine receptor subunit alpha-5 [Source:RefSeq peptide;Acc:NP_001017885]
Human Orthologue:
CHRNA5
Human Description:
cholinergic receptor, nicotinic, alpha 5 [Source:HGNC Symbol;Acc:1959]
Mouse Orthologue:
Chrna5
Mouse Description:
cholinergic receptor, nicotinic, alpha polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:87889]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa367 Nonsense Available for shipment Available now
sa23361 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021372 Nonsense 133 466 6 9
Genomic Location:
Chromosome 18 (position 38790175)
KASP Assay ID:
554-0237.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTGTCTATATCTCATGGTTGGTTGATTGCAGTGCAGATGGTAATTTC[G/T]AGGCCACAGTGACAAAAGCAGTGGTGAGATTTGATGGCACAATCTCCTGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa23361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021372 Essential Splice Site 186 466 6 9
Genomic Location:
Chromosome 18 (position 38790012)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAACTGCTCCATGAAGTTCGGTTCTTGGACCTATGATGGCTCCCAGG[T/C]ATGTTTTTAATTATTATTAGACACCAAAAGCCAAATTCATGTTGTTTCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/msqchz14