chrna5

Ensembl ID:
ENSDARG00000003420
ZFIN ID:
ZDB-GENE-050417-440
Description:
neuronal acetylcholine receptor subunit alpha-5 [Source:RefSeq peptide;Acc:NP_001017885]
Human Orthologue:
CHRNA5
Human Description:
cholinergic receptor, nicotinic, alpha 5 [Source:HGNC Symbol;Acc:1959]
Mouse Orthologue:
Chrna5
Mouse Description:
cholinergic receptor, nicotinic, alpha polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:87889]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45648 Essential Splice Site Mutation detected in F1 DNA During 2018
sa367 Nonsense Available for shipment Available now
sa23361 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa45648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021372 Essential Splice Site 127 466 5 9
Genomic Location (Zv9):
Chromosome 18 (position 38790886)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40503603
GRCz11 18 40493795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGTGCCTTCAGACTCCATCTGGATTCCTGACATTGTGCTCTATGACAA[G/A]TATGTGGTGTTAGAAAGTTTATAAGTCACGCTGCAATTGTTTGTCAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021372 Nonsense 133 466 6 9
Genomic Location (Zv9):
Chromosome 18 (position 38790175)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40502892
GRCz11 18 40493084
KASP Assay ID:
554-0237.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTGTCTATATCTCATGGTTGGTTGATTGCAGTGCAGATGGTAATTTC[G/T]AGGCCACAGTGACAAAAGCAGTGGTGAGATTTGATGGCACAATCTCCTGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa23361
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021372 Essential Splice Site 186 466 6 9
Genomic Location (Zv9):
Chromosome 18 (position 38790012)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40502729
GRCz11 18 40492921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAACTGCTCCATGAAGTTCGGTTCTTGGACCTATGATGGCTCCCAGG[T/C]ATGTTTTTAATTATTATTAGACACCAAAAGCCAAATTCATGTTGTTTCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link