capslb

Ensembl ID:
ENSDARG00000003414
ZFIN ID:
ZDB-GENE-050417-298
Description:
calcyphosin-like protein [Source:RefSeq peptide;Acc:NP_001017776]
Human Orthologue:
CAPSL
Human Description:
calcyphosine-like [Source:HGNC Symbol;Acc:28375]
Mouse Orthologue:
Capsl
Mouse Description:
calcyphosine-like Gene [Source:MGI Symbol;Acc:MGI:1922818]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32346 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043786 Nonsense 26 199 2 6
ENSDART00000133190 Nonsense 75 248 2 6
Genomic Location (Zv9):
Chromosome 21 (position 21376939)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22388432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGAGTGTTCAGACCCCATTGAGCGTCTGCGGCTGCAGTGTTTGTCC[C/T]GAGGATGTGCGGGCATCAAGGGACTGGGCAGGTACAGTATTCATAAGATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: Robust associations of four new chromosome regions from genome-wide analyses of type 1 diabetes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link