si:ch211-1c4.1

Ensembl ID:
ENSDARG00000003403
ZFIN ID:
ZDB-GENE-060531-26
Description:
Novel protein similar to vertebrate odz, odd Oz/ten-m (Drosophila) family [Source:UniProtKB/TrEMBL;A
Human Orthologue:
ODZ1
Human Description:
odz, odd Oz/ten-m homolog 1(Drosophila) [Source:HGNC Symbol;Acc:8117]
Mouse Orthologue:
Odz1
Mouse Description:
odd Oz/ten-m homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1345185]

Alleles

There are 14 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40401 Nonsense Mutation detected in F1 DNA During 2017
sa14203 Nonsense Available for shipment Available now
sa5812 Essential Splice Site F2 line generated During 2017
sa2238 Essential Splice Site F2 line generated During 2017
sa33576 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31428 Essential Splice Site, Splice Site Available for shipment Available now
sa2239 Essential Splice Site F2 line generated During 2017
sa11851 Nonsense Available for shipment Available now
sa38462 Nonsense Mutation detected in F1 DNA During 2017
sa16414 Nonsense Available for shipment Available now
sa16472 Nonsense Available for shipment Available now
sa25295 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20387 Nonsense Available for shipment Available now
sa20386 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040184 Nonsense 209 2571 3 29
ENSDART00000144198 Nonsense 49 2389 1 25
Genomic Location (Zv9):
Chromosome 5 (position 23205575)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20918447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTGATTTCACCTTCACTCCTGTCCACCTGCCAGGACTCAACACCACA[C/T]AGCCGGGTATGTATGTGTGTGTTACTTCAGTCATCACATAAGGTTTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14203
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040184 Nonsense 551 2571 9 29
ENSDART00000144198 Nonsense 388 2389 7 25
Genomic Location (Zv9):
Chromosome 5 (position 23176780)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20889652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGRCGTTGTCAGTGCGAGGAAGGGTGGGAGGGAACCACTTGTGACAAA[C/T]AGCCCTGCCATCCAATCTGTGAAGAGCATGGAGAATGCAGGGACGGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5812
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040184 Essential Splice Site 582 2571 9 29
ENSDART00000144198 Essential Splice Site 419 2389 7 25
ENSDART00000040184 Essential Splice Site 582 2571 None 29
ENSDART00000144198 Essential Splice Site 419 2389 None 25
Genomic Location (Zv9):
Chromosome 5 (position 23176685)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20889557
KASP Assay ID:
554-3059.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCAGTGTGTCTGTCAGCCTGGTTGGGAGGGAGAGCACTGCACTATTGG[T/C]AAGTTCTTATAAGTTAATGCACACTGACAATAAGACATTTGCATTAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2238
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040184 Essential Splice Site 582 2571 9 29
ENSDART00000144198 Essential Splice Site 419 2389 7 25
ENSDART00000040184 Essential Splice Site 582 2571 None 29
ENSDART00000144198 Essential Splice Site 419 2389 None 25
Genomic Location (Zv9):
Chromosome 5 (position 23176685)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20889557
KASP Assay ID:
554-3059.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCAGTGTGTCTGTCAGCCTGGTTGGGAGGGAGAGCACTGCACTATTGG[T/C]AAGTTCTTATAAGTTAATGCACACTGACAATAAGACATTTGCATTAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040184 Essential Splice Site 641 2571 11 29
ENSDART00000144198 Essential Splice Site 468 2389 8 25
Genomic Location (Zv9):
Chromosome 5 (position 23170841)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20883713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGTCGTCATGGAAACCGAGTGCAATGACAGTAAAGATAATGACAGCGG[T/C]AAAGAACTCTATAGGAGATGAGCTGTGTGAATGAATGAAGCTTTAGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040184 Essential Splice Site 641 2571 12 29
ENSDART00000144198 Splice Site None 2389 None 25
Genomic Location (Zv9):
Chromosome 5 (position 23167554)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20880426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCATCAAGGCTACATGTCTCATGTAAAGTGTGTGTGTGTGTGTGTTTT[T/C]CAGATGGTCTCATGGACTGTGTCGACCCAGACTGTTGTAGTCAGCAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2239
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040184 Essential Splice Site 714 2571 12 29
ENSDART00000144198 Essential Splice Site 540 2389 9 25
Genomic Location (Zv9):
Chromosome 5 (position 23167332)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20880204
KASP Assay ID:
554-3082.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGGGACAGCACACACATACTACCAGGAGACCTGCCATTTGACAGCAGG[T/C]GAAAAACAAACGCTTGTAAATATTTGCACTCTCAAATGCACACAAAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11851
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040184 Nonsense 746 2571 13 29
ENSDART00000144198 Nonsense 572 2389 10 25
Genomic Location (Zv9):
Chromosome 5 (position 23162797)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20875669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTCGTTGGCGTGAACGTCACGYTTCAGCATAACCCTGAGTATGGGTA[C/A]ACACTCAGCCGGCAAGACGGCAGGTAACACACACTCTAAWGCACTTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38462
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040184 Nonsense 771 2571 14 29
ENSDART00000144198 Nonsense 597 2389 11 25
Genomic Location (Zv9):
Chromosome 5 (position 23160404)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20873276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTGATCTTCTGGCAGTGGGTGGAATCTCAGTGTCTCTTGTATTCCAG[C/T]GAGCCCCATTTTTGTCCCAGATTCGGTCGGTCTGGCTTCCTTGGAACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16414
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040184 Nonsense 1333 2571 22 29
ENSDART00000144198 Nonsense 1151 2389 18 25
ENSDART00000040184 Nonsense 1333 2571 22 29
ENSDART00000144198 Nonsense 1151 2389 18 25
Genomic Location (Zv9):
Chromosome 5 (position 23115135)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20828007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGAATGTGTCCCCAGGTGACGGAGGTTACGCTCGCGATGCCAAGCTG[A/T]AGTCTCCCTCATCTCTAGCGGTTTCTCCTAATGGCTCCCTCTGCATCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040184 Nonsense 1333 2571 22 29
ENSDART00000144198 Nonsense 1151 2389 18 25
ENSDART00000040184 Nonsense 1333 2571 22 29
ENSDART00000144198 Nonsense 1151 2389 18 25
Genomic Location (Zv9):
Chromosome 5 (position 23115135)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20828007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGAATGTGTCCCCAGGTGACGGAGGTTACGCTCGCGATGCCAAGCTG[A/T]AGTCTCCCTCATCTCTAGCGGTTTCTCCTAATGGCTCCCTCTGCATCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25295
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040184 Essential Splice Site 1863 2571 26 29
ENSDART00000144198 Essential Splice Site 1681 2389 22 25
Genomic Location (Zv9):
Chromosome 5 (position 23090698)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20803570
KASP Assay ID:
554-7664.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCTGATGCACGAAGGATTCGTTTGCACCATACGCTACAGACAGACAG[G/A]TAAAAACAACACACTGACAATAAGTCATAGTGCATTAATCTTTCATAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20387
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040184 Nonsense 1930 2571 27 29
ENSDART00000144198 Nonsense 1748 2389 23 25
Genomic Location (Zv9):
Chromosome 5 (position 23085328)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20798200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGTGTCTGGACGTATCGAGCAATTCGGGAAGTTCAGTGTCATCAACTA[C/A]GACTTGAACCAGGTCATCACCACACATGCCATGAAGCACACTAAAATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040184 Nonsense 2044 2571 27 29
ENSDART00000144198 Nonsense 1862 2389 23 25
Genomic Location (Zv9):
Chromosome 5 (position 23084988)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20797860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGAGTCACGGCAACAGTGCGCGATTGACACCATTGCGTTACGATCTT[C/T]GAGATCGTATCACGCGGCTTGGAGAAATCCAGTATCGCACTGATGAAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link