fgf8a

Ensembl ID:
ENSDARG00000003399
ZFIN ID:
ZDB-GENE-990415-72
Description:
fibroblast growth factor 8 [Source:RefSeq peptide;Acc:NP_571356]
Human Orthologue:
FGF8
Human Description:
fibroblast growth factor 8 (androgen-induced) [Source:HGNC Symbol;Acc:3686]
Mouse Orthologue:
Fgf8
Mouse Description:
fibroblast growth factor 8 Gene [Source:MGI Symbol;Acc:MGI:99604]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2694 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2694
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025583 Nonsense 178 210 5 5
ENSDART00000144968 Nonsense 167 199 5 5
Genomic Location:
Chromosome 13 (position 28724446)
KASP Assay ID:
554-2909.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCTCCAAAACCAGGCAACACCAGCGGGAAGTCCACTTCATGAAGAGGT[T/A]GCCCAAGGGACACCAAATCGCAGAGCACAGACCCTTTGATTTCATCAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i8vypylc