col4a3

Ensembl ID:
ENSDARG00000003395
ZFIN ID:
ZDB-GENE-070802-4
Description:
Type IV collagen alpha 3 chain [Source:UniProtKB/TrEMBL;Acc:Q58FS7]
Human Orthologue:
COL4A3
Human Description:
collagen, type IV, alpha 3 (Goodpasture antigen) [Source:HGNC Symbol;Acc:2204]
Mouse Orthologue:
Col4a3
Mouse Description:
collagen, type IV, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:104688]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12489 Nonsense Available for shipment Available now
sa22698 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049849 Nonsense 538 1664 25 52
Genomic Location:
Chromosome 15 (position 35362174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGTTTTCCAGGGCCTTCAGGCCCCAAGGGAGAAATGGGGATGAAATA[T/A]GAGATTGGGRAAAAAGGCTTTAAAGGAGACACTGGTGCAGTAGGACTRTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049849 Nonsense 823 1664 32 52
Genomic Location:
Chromosome 15 (position 35366134)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCTCAATGAAGGTCACTGGGGCACATACTGTATATTGTTTTTAGGTT[T/A]GCCAGGTTTGAAAGGGCCACAAGGTGAAACTGGACTACCTGGATTGAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wrlfzbcx