col4a3

Ensembl ID:
ENSDARG00000003395
ZFIN ID:
ZDB-GENE-070802-4
Description:
Type IV collagen alpha 3 chain [Source:UniProtKB/TrEMBL;Acc:Q58FS7]
Human Orthologue:
COL4A3
Human Description:
collagen, type IV, alpha 3 (Goodpasture antigen) [Source:HGNC Symbol;Acc:2204]
Mouse Orthologue:
Col4a3
Mouse Description:
collagen, type IV, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:104688]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12489 Nonsense Available for shipment Available now
sa22698 Nonsense Available for shipment Available now
sa42602 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049849 Nonsense 538 1664 25 52
Genomic Location (Zv9):
Chromosome 15 (position 35362174)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36236365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGTTTTCCAGGGCCTTCAGGCCCCAAGGGAGAAATGGGGATGAAATA[T/A]GAGATTGGGRAAAAAGGCTTTAAAGGAGACACTGGTGCAGTAGGACTRTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22698
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049849 Nonsense 823 1664 32 52
Genomic Location (Zv9):
Chromosome 15 (position 35366134)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36240325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCTCAATGAAGGTCACTGGGGCACATACTGTATATTGTTTTTAGGTT[T/A]GCCAGGTTTGAAAGGGCCACAAGGTGAAACTGGACTACCTGGATTGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049849 Essential Splice Site 1105 1664 39 52
Genomic Location (Zv9):
Chromosome 15 (position 35368989)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36243180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTTTTTTATTAAATAACAATATTTTGTTATGTATTGTGATTTTTATC[A/T]GGACCCCCAGGAGAAGCTGGTGATGATGGGTTTGATGGATTTCCAGGTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link