asb8

Ensembl ID:
ENSDARG00000003383
ZFIN ID:
ZDB-GENE-030131-5411
Description:
ankyrin repeat and SOCS box protein 8 [Source:RefSeq peptide;Acc:NP_956064]
Human Orthologue:
ASB8
Human Description:
ankyrin repeat and SOCS box-containing 8 [Source:HGNC Symbol;Acc:17183]
Mouse Orthologue:
Asb8
Mouse Description:
ankyrin repeat and SOCS box-containing 8 Gene [Source:MGI Symbol;Acc:MGI:1925791]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5055 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013797 Nonsense 92 289 4 4
ENSDART00000122686 Nonsense 92 289 3 3
ENSDART00000137229 Nonsense 92 229 4 4
ENSDART00000145007 Nonsense 92 169 4 4
Genomic Location:
Chromosome 23 (position 27740150)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCATGCAGGTAAACGCCTTGGAYGGCTACAACCGCACCGCCCTTCATTA[C/A]GCAGCAGAGAAAGACGAGGGTTGTGTGGAGCTGCTTCTGGAGTACGGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g6f7edco