si:dkey-19p15.9

Ensembl ID:
ENSDARG00000003328
ZFIN ID:
ZDB-GENE-081107-61
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JIW6]
Human Orthologues:
FAM178A, FAM178B
Human Descriptions:
family with sequence similarity 178, member A [Source:HGNC Symbol;Acc:17814]
family with sequence similarity 178, member B [Source:HGNC Symbol;Acc:28036]
Mouse Orthologues:
Fam178a, Fam178b
Mouse Descriptions:
family with sequence similarity 178, member A Gene [Source:MGI Symbol;Acc:MGI:1924968]
family with sequence similarity 178, member B Gene [Source:MGI Symbol;Acc:MGI:3026913]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15823 Nonsense Available for shipment Available now
sa13972 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15823
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058065 Nonsense 188 1212 3 20
ENSDART00000136689   None 363 None 11
Genomic Location (Zv9):
Chromosome 13 (position 8988100)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9290720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGCGCAAWTCACTCTTAWTCCAGCAGAGACCGAGRAACTCATCCGGG[C/T]AATTCACCCACAACCCCAATCAGAAAAAAGACAGAATGGATAATAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13972
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058065 Essential Splice Site 922 1212 15 20
ENSDART00000136689 Essential Splice Site 216 363 6 11
Genomic Location (Zv9):
Chromosome 13 (position 9009314)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9311934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTTGAAWCACACCTGCACTTATAATCCCTCGGGCACAGATTTTAAGG[T/A]GAGAATAATTCATTCAATATCAGCTGCTTTTTGATGTTKACAATTCAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link