dcp1a

Ensembl ID:
ENSDARG00000003323
ZFIN ID:
ZDB-GENE-030723-5
Description:
mRNA-decapping enzyme 1A [Source:RefSeq peptide;Acc:NP_878313]
Mouse Orthologue:
Dcp1a
Mouse Description:
DCP1 decapping enzyme homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1923151]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30464 Nonsense Mutation detected in F1 DNA During 2017
sa44420 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30463 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30464
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017567 Nonsense 151 439 5 10
Genomic Location (Zv9):
Chromosome Zv9_NA698 (position 45198)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53012360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTGTGTCTCCAGACAGAAGTGTGAGCATCAGGACCAATGGCTGCGTT[C/T]AGAACAGACCCGCAGGCATCCTGGAGCTGCTCAGCAAAGCCAAAGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017567 Essential Splice Site 170 439 5 10
Genomic Location (Zv9):
Chromosome Zv9_NA698 (position 45137)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53012421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGGCATCCTGGAGCTGCTCAGCAAAGCCAAAGAGGAGTATCAGAGGG[T/C]AAATCTCAAGATCAAAACATCTCATCAGTCCACATCAAATCAAAGCTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30463
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017567 Nonsense 343 439 8 10
Genomic Location (Zv9):
Chromosome Zv9_NA698 (position 40147)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53017450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATCTTTTCCTGTCTCCATCACAGGGTAAAGAAGTGAACGCCTTCACG[C/T]AGCCCCCGGCTCTGGTCAAACCCGTCCCAGTAAGTTCCCTCTGCAGATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link