fam91a1

Ensembl ID:
ENSDARG00000003320
ZFIN ID:
ZDB-GENE-040426-1187
Description:
Protein FAM91A1 [Source:UniProtKB/Swiss-Prot;Acc:Q6TEP1]
Human Orthologue:
FAM91A1
Human Description:
family with sequence similarity 91, member A1 [Source:HGNC Symbol;Acc:26306]
Mouse Orthologue:
D15Ertd621e
Mouse Description:
DNA segment, Chr 15, ERATO Doi 621, expressed Gene [Source:MGI Symbol;Acc:MGI:1277178]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13807 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13807
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019459 Essential Splice Site 357 831 12 24
Genomic Location:
Chromosome 19 (position 34492847)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAGGTTCCTCGGYCACTGATACAGAYACCACCAGCCTGGAGGATCAGG[G/A]TGAGAGATGGGCTCACTGAATGATAAACMATGTAAACAGCGGCGGTGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ck2qti9o