im:7147678

Ensembl ID:
ENSDARG00000003313
ZFIN ID:
ZDB-GENE-050506-143
Human Orthologue:
EPS8L1
Human Description:
EPS8-like 1 [Source:HGNC Symbol;Acc:21295]
Mouse Orthologue:
Eps8l1
Mouse Description:
EPS8-like 1 Gene [Source:MGI Symbol;Acc:MGI:1914675]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24555 Essential Splice Site Available for shipment Available now
sa37957 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023519 Essential Splice Site 123 505 4 14
Genomic Location (Zv9):
Chromosome 24 (position 40191698)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38790489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGTTTATCGACACTTTTCAGAAATTCAAATACTGTTTGGGCCTTTTG[G/A]TGAGTGATTAATGCTAATATAAAAAAATTAAATAATAATAATAATAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37957
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023519 Essential Splice Site 478 505 14 14
Genomic Location (Zv9):
Chromosome 24 (position 40207938)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38806729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTTCACAATACACACACTAACCGTCTGTATATCTGTCTGTGTGTGTC[A/T]GGATGCTCACAGAGCCTCAGAGCTGGAGACGGTGATGGAGAAACAGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link