ttc35

Ensembl ID:
ENSDARG00000003308
ZFIN ID:
ZDB-GENE-040625-82
Description:
Tetratricopeptide repeat protein 35 [Source:UniProtKB/Swiss-Prot;Acc:Q6TGY8]
Human Orthologue:
TTC35
Human Description:
tetratricopeptide repeat domain 35 [Source:HGNC Symbol;Acc:28963]
Mouse Orthologue:
Ttc35
Mouse Description:
tetratricopeptide repeat domain 35 Gene [Source:MGI Symbol;Acc:MGI:1913986]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17192 Essential Splice Site Available for shipment Available now
sa17729 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023238 Essential Splice Site 14 297 1 11
Genomic Location:
Chromosome 16 (position 41325335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAAAACATGTCGTCCATATCGGAGCTGTACGATGTCACTTGGGAAGG[T/C]AAATKACTTTATTTTCGTTAACAGCGCTTATTACGTGATTTACTTACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17729
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023238 Essential Splice Site 170 297 7 11
Genomic Location:
Chromosome 16 (position 41361315)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGGAAGCCTGGCATGAGCTGTCCGAACTCTACATCAATGAGCATGAG[T/A]AATTCTTACCNNNNNNCTTNNNNNNNNTTTCTTTCTTTCTAAACATGCAATTTGATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4ifz5xy5