ttc35

Ensembl ID:
ENSDARG00000003308
ZFIN ID:
ZDB-GENE-040625-82
Description:
Tetratricopeptide repeat protein 35 [Source:UniProtKB/Swiss-Prot;Acc:Q6TGY8]
Human Orthologue:
TTC35
Human Description:
tetratricopeptide repeat domain 35 [Source:HGNC Symbol;Acc:28963]
Mouse Orthologue:
Ttc35
Mouse Description:
tetratricopeptide repeat domain 35 Gene [Source:MGI Symbol;Acc:MGI:1913986]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17192 Essential Splice Site Available for shipment Available now
sa36218 Nonsense Mutation detected in F1 DNA During 2016
sa17729 Essential Splice Site Available for shipment Available now
sa42787 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023238 Essential Splice Site 14 297 1 11
Genomic Location:
Chromosome 16 (position 41325335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAAAACATGTCGTCCATATCGGAGCTGTACGATGTCACTTGGGAAGG[T/C]AAATKACTTTATTTTCGTTAACAGCGCTTATTACGTGATTTACTTACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023238 Nonsense 39 297 2 11
Genomic Location:
Chromosome 16 (position 41328887)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGGAAGAGAATTACAGGAACAGTGAGCAGATTGTGGATGTCGGTGAA[G/T]AGCTGATTAATGAGCATGCGTCTAAACTGGGAGATGACAGTAAGTACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17729
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023238 Essential Splice Site 170 297 7 11
Genomic Location:
Chromosome 16 (position 41361315)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGGAAGCCTGGCATGAGCTGTCCGAACTCTACATCAATGAGCATGAG[T/A]AATTCTTACCNNNNNNCTTNNNNNNNNTTTCTTTCTTTCTAAACATGCAATTTGATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42787
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023238 Essential Splice Site 170 297 8 11
Genomic Location:
Chromosome 16 (position 41370912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCCATTAAAGTTTTTTTCTCTCTCTCTCTTTTCTTGTTTGATTCTCAC[A/T]GTTATGCAAAAGCAGCTTTTTGTCTTGAAGAGCTGATGATGACAAACCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link