dab1b

Ensembl ID:
ENSDARG00000003290
ZFIN ID:
ZDB-GENE-060421-7958
Description:
disabled 1 type B isoform 2 [Source:RefSeq peptide;Acc:NP_001128514]
Human Orthologue:
DAB1
Human Description:
disabled homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:2661]
Mouse Orthologue:
Dab1
Mouse Description:
disabled homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108554]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19653 Nonsense Available for shipment Available now
sa2048 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa19653
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013794 Nonsense 121 227 5 8
ENSDART00000082155 Nonsense 121 227 5 9
ENSDART00000108481 Nonsense 130 482 4 11
ENSDART00000111272 Nonsense 130 440 4 9
ENSDART00000132797 Nonsense 121 511 5 14
Genomic Location (Zv9):
Chromosome 2 (position 2558823)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2426475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGCATCATCACTCTGTTCATGAAATCTCCTACATTGCCAAAGACTCA[C/T]GAGACCATCGCGCCTTCGGCTATGTGTGCGGGAAAAAAGGCAACCACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2048
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013794 Nonsense 180 227 6 8
ENSDART00000082155 Nonsense 180 227 6 9
ENSDART00000108481 Nonsense 189 482 5 11
ENSDART00000111272 Nonsense 189 440 5 9
ENSDART00000132797 Nonsense 180 511 6 14
Genomic Location (Zv9):
Chromosome 2 (position 2557152)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2424804
KASP Assay ID:
554-2997.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAAACAAAGGGAAGAAGCAGAAAAAAAGAGCCAGAAGGAAAAACACTG[T/A]GAACAAGTCATCTATCAGGTAAGATTGTTAATGCATTAACTAATGGARCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link