pik3ip1

Ensembl ID:
ENSDARG00000003281
ZFIN ID:
ZDB-GENE-031030-14
Description:
Phosphoinositide-3-kinase-interacting protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXB3]
Human Orthologue:
PIK3IP1
Human Description:
phosphoinositide-3-kinase interacting protein 1 [Source:HGNC Symbol;Acc:24942]
Mouse Orthologue:
Pik3ip1
Mouse Description:
phosphoinositide-3-kinase interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917016]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40396 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012844 Nonsense 91 263 3 6
ENSDART00000134697 Nonsense 93 265 3 6
Genomic Location (Zv9):
Chromosome 5 (position 22661727)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20374599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAAATAAACCCTGGTGCTATGTCTCCGGGTCAAGTGGAGAAACCAAA[A/T]AAGAAGCATGTGATATCAGGATATGCCAAGGTAGTCATATTTATTCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link