pop4

Ensembl ID:
ENSDARG00000003263
ZFIN ID:
ZDB-GENE-050522-505
Description:
processing of precursor 4 [Source:RefSeq peptide;Acc:NP_001018585]
Human Orthologue:
POP4
Human Description:
processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) [Source:HGNC Symbol;Acc:30081]
Mouse Orthologue:
Pop4
Mouse Description:
processing of precursor 4, ribonuclease P/MRP family, (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MG

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34158 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011823 Essential Splice Site 174 219 6 7

The following transcripts of ENSDARG00000003263 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 47576325)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 45694436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACTGAAGCACATCTTCAAACTCATTACAAAAGAGGACAAACTAAAAG[G/A]TATTTATGTTGTGTAATGTGTGTGACGTTTAAATGAAATGAGTGAGCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link