pik3cd

Ensembl ID:
ENSDARG00000003250
ZFIN ID:
ZDB-GENE-040426-1128
Description:
phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta isoform [Source:RefSeq pepti
Human Orthologue:
PIK3CD
Human Description:
phosphoinositide-3-kinase, catalytic, delta polypeptide [Source:HGNC Symbol;Acc:8977]
Mouse Orthologue:
Pik3cd
Mouse Description:
phosphatidylinositol 3-kinase catalytic delta polypeptide Gene [Source:MGI Symbol;Acc:MGI:1098211]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44012 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39416 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44011 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8987 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006120 Essential Splice Site 48 1039 3 23
Genomic Location (Zv9):
Chromosome 23 (position 30051273)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 29881840
GRCz11 23 29808381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGGTGAACCATCCCTTTAACTAAATCTTGATGTGTGGCTTCTGTGTTA[A/G]GATGCTGTGGAAGAACGCCAAGAATGAGCCTCTGTTCAGTGCTCTTAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006120 Essential Splice Site 259 1039 5 23
Genomic Location (Zv9):
Chromosome 23 (position 30042820)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 29873387
GRCz11 23 29799928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGAGATGGGAGTTCATTTATGGAAAATATCCACTCTGCCAGTTCAAAG[T/A]AAGTCTGTGAAAACCACAACAACATCTTCTCAACTTCAGTGTTAGATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006120 Essential Splice Site 311 1039 6 23
Genomic Location (Zv9):
Chromosome 23 (position 30039518)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 29870085
GRCz11 23 29796626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCAGAAGCCGTGCTCAGTCCAAACCACCACCGCTGCCTCTGAAAAGGG[T/A]GAGAAGGCACTTTTACACCATAACACTGCGCATTATTAAGGGGAACTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006120 Essential Splice Site 951 1039 21 23
Genomic Location (Zv9):
Chromosome 23 (position 30006985)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 29837552
GRCz11 23 29764093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCATGTAATTCAGGAGGGACGRACCAACAACAGYGAGAAATTCGAAAG[G/A]TCRGTGCACATYTRATATGTAAATAACTAAAGCAACTCAAAATATCCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link