gbp3

Ensembl ID:
ENSDARG00000003244
ZFIN ID:
ZDB-GENE-070912-176
Description:
Novel protein similar to vertebrate guanylate binding protein family [Source:UniProtKB/TrEMBL;Acc:B0
Human Orthologues:
GBP1, GBP2, GBP3, GBP4, GBP5, GBP6, GBP7
Human Descriptions:
guanylate binding protein 1, interferon-inducible, 67kDa [Source:HGNC Symbol;Acc:4182]
guanylate binding protein 2, interferon-inducible [Source:HGNC Symbol;Acc:4183]
guanylate binding protein 3 [Source:HGNC Symbol;Acc:4184]
guanylate binding protein 4 [Source:HGNC Symbol;Acc:20480]
guanylate binding protein 5 [Source:HGNC Symbol;Acc:19895]
guanylate binding protein 7 [Source:HGNC Symbol;Acc:29606]
guanylate binding protein family, member 6 [Source:HGNC Symbol;Acc:25395]
Mouse Orthologues:
AC113980.1, Gbp1, Gbp10, Gbp2, Gbp3, Gbp4, Gbp5, Gbp6, Gbp7, Gbp8, Gbp9
Mouse Descriptions:
guanylate binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:95666]
Guanylate binding protein 11 [Source:UniProtKB/TrEMBL;Acc:A9YVJ5]
guanylate binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:102772]
guanylate binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1926263]
guanylate binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:97072]
guanylate binding protein 5 Gene [Source:MGI Symbol;Acc:MGI:2429943]
guanylate binding protein 6 Gene [Source:MGI Symbol;Acc:MGI:2140937]
guanylate binding protein 7 Gene [Source:MGI Symbol;Acc:MGI:2444421]
guanylate-binding protein 10 Gene [Source:MGI Symbol;Acc:MGI:4359647]
guanylate-binding protein 8 Gene [Source:MGI Symbol;Acc:MGI:1923324]
guanylate-binding protein 9 Gene [Source:MGI Symbol;Acc:MGI:3605620]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12440 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12440
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007074 Essential Splice Site 533 965 9 18
ENSDART00000143885 Essential Splice Site 533 965 11 20
Genomic Location:
Chromosome 2 (position 43966236)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGAAAATCAGGAGAGAYGATGACCAAGCCCTAAAAGCCAAACACAAGG[T/C]AAAAGCAGGACATCGAAAAACGTTCATATTAGCTTTATTTCCATGTTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1axl1vnz