nup88

Ensembl ID:
ENSDARG00000003235
ZFIN ID:
ZDB-GENE-050522-297
Description:
nuclear pore complex protein Nup88 [Source:RefSeq peptide;Acc:NP_001018302]
Human Orthologue:
NUP88
Human Description:
nucleoporin 88kDa [Source:HGNC Symbol;Acc:8067]
Mouse Orthologue:
Nup88
Mouse Description:
nucleoporin 88 Gene [Source:MGI Symbol;Acc:MGI:104900]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20553 Nonsense Mutation detected in F1 DNA During 2014
sa2206 Nonsense Available for shipment Available now
sa20552 Essential Splice Site Available for shipment Available now
sa9811 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20553
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023123 Nonsense 180 720 4 17
Genomic Location:
Chromosome 5 (position 60806192)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACTGGATTATACAAAGTATGTTTGTTTGTTTTTTACCACCAGATTTTA[T/A]AATCTTAAGGAGCCCCAGTCCCCTGCTAGAGTTTTATCTGTGTCTCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023123 Nonsense 244 720 5 17
Genomic Location:
Chromosome 5 (position 60801222)
KASP Assay ID:
554-2590.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCTCCTCACCTGAGCAGTCTGCGAATGAAGGCAGAGCTGGTGGTTTA[T/A]CCACTYTACATACTATACGGCAATGGAGAGACCTTTCTGAACTACATCTC
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Stage Entity Entity Quality Tag
Larval:Day 4
ZFS:0000036
eye
ZFA:0000107

decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
gut
ZFA:0000112

quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
head
ZFA:0001114

decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
liver
ZFA:0000123

hypoplastic
PATO:0000645
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
melanocyte
ZFA:0009091

quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
swim bladder
ZFA:0000076

aplastic
PATO:0001483
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
whole organism
ZFA:0001094
anterior/posterior axis
BSPO:0000013
increased length
PATO:0000573
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
yolk
ZFA:0000084

increased size
PATO:0000586
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
4:22070001-22070954 22070954 1 2.48 × 10-50 2.7 15 mdm2 ENSDARG00000033443
24:37750001-37750738 37750738 1 6.18 × 10-42 1.5 0 riok3 ENSDARG00000042751
5:48101731-48102200 48101731 -1 1.26 × 10-37 1.1 -2 hapln1a ENSDARG00000089769
9:23214820-23215200 23214820 -1 1.12 × 10-34 -1.3 -58 crygm2d6 ENSDARG00000073874
14:23142501-23143173 23143173 1 4.70 × 10-32 1.7 -5 ccng1 ENSDARG00000076667

Mutation Details

Allele Name:
sa20552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023123 Essential Splice Site 327 720 6 17
Genomic Location:
Chromosome 5 (position 60799972)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTATCACTGTGTGGTGCTGGAGGCAGAGGAAGAGGAGGATGGCGGAG[T/A]AAGACATCCACAATTCAGCCATAAATCAGCTGATGCACGGTAAGAGATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023123 Nonsense 693 720 16 17
Genomic Location:
Chromosome 5 (position 60790597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCCGGCTCACTCCAGCCTCACTCTAAAYGCCCACCAGAGGAAGTGTT[T/A]GCAGGGAGTGCTGAAAGAACAGTACGTACACACACTTTACAASTGCYTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t3v20hb4