gdf9

Ensembl ID:
ENSDARG00000003229
ZFIN ID:
ZDB-GENE-050221-7
Description:
growth/differentiation factor 9 [Source:RefSeq peptide;Acc:NP_001012383]
Human Orthologue:
GDF9
Human Description:
growth differentiation factor 9 [Source:HGNC Symbol;Acc:4224]
Mouse Orthologue:
Gdf9
Mouse Description:
growth differentiation factor 9 Gene [Source:MGI Symbol;Acc:MGI:95692]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22468 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019296 Nonsense 127 418 2 2
Genomic Location (Zv9):
Chromosome 14 (position 23465520)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22165310
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATGACTTGTTTTATTTTGTCAGAATTCTTCATGCAAGACATTTCCTA[C/A]AGTCTGAATCGAGTGAGGTCACAAGAACACTTGCTAAAATCCGTCCTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link