bin2a

Ensembl ID:
ENSDARG00000003219
ZFIN ID:
ZDB-GENE-041114-126
Description:
bridging integrator 2a [Source:RefSeq peptide;Acc:NP_001007422]
Human Orthologue:
BIN2
Human Description:
bridging integrator 2 [Source:HGNC Symbol;Acc:1053]
Mouse Orthologue:
Bin2
Mouse Description:
bridging integrator 2 Gene [Source:MGI Symbol;Acc:MGI:3611448]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24382 Nonsense Mutation detected in F1 DNA During 2014
sa15980 Essential Splice Site Available for shipment Available now
sa24381 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025196 Nonsense 45 463 3 14

The following transcripts of ENSDARG00000003219 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 33961429)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTTGCAGGTCTTGCAGAGGCTTGGTAAATCTGAGGAGACCAAAGAT[G/T]AGCACTTTGAGCAGTGCGTGATGAACCTTCACATGCAACAGGTATCTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15980
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025196 Essential Splice Site 176 463 7 14

The following transcripts of ENSDARG00000003219 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 33959419)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACAGRGCTGCAGAATGCYAAGAAGAGGGACGATATCAAAATTGGAAAG[G/A]TAATATTATTCTTCCGGAAGTTACTGATAATTTTCWACCAATTTTACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025196 Nonsense 275 463 11 14

The following transcripts of ENSDARG00000003219 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 33958470)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGGGCTCCTTGAAGAGAAGGTCATTCAGAGACACTTTGTCCCCCAGAT[C/A]ACTTAAAAGCTTTTATGATTTCCACATGACTATGAACCCCAGAGGCTCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fc7d7gqh