anxa2a

Ensembl ID:
ENSDARG00000003216
ZFIN ID:
ZDB-GENE-030131-4282
Description:
annexin A2a [Source:RefSeq peptide;Acc:NP_861426]
Human Orthologue:
ANXA2
Human Description:
annexin A2 [Source:HGNC Symbol;Acc:537]
Mouse Orthologue:
Anxa2
Mouse Description:
annexin A2 Gene [Source:MGI Symbol;Acc:MGI:88246]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25237 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24716 Nonsense Mutation detected in F1 DNA During 2014
sa10952 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011967 Essential Splice Site 48 337 4 13
Genomic Location:
Chromosome 25 (position 35063815)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTGCTATTATATTACAGTTTTGATAAATAAACATGGCTGTTTGTTTT[A/G]GGGGTGGATGAGCAAACCATAATTGACATCCTCACCAAACGGACATACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011967 Nonsense 137 337 6 13
Genomic Location:
Chromosome 25 (position 35067144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACAGACGAAGAGTCTCTGATTGAGATCCTCTGCTCTCGAAGCAATGCT[G/T]AGATCATGGAGATCAAGAAAGTCTACAGGGAATGTGAGTATGGCAGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011967 Essential Splice Site 258 337 10 13
Genomic Location:
Chromosome 25 (position 35069146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATYCGCAAAGAGGTCAAAGGAGAYCTAGAGAAGTCCTTCCTGACCCTCGG[T/G]GAGAGCCTTCATCTACAAACACCYCAKACAACTGACTTCTGATATCATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7zz5qq1o