anxa2a

Ensembl ID:
ENSDARG00000003216
ZFIN ID:
ZDB-GENE-030131-4282
Description:
annexin A2a [Source:RefSeq peptide;Acc:NP_861426]
Human Orthologue:
ANXA2
Human Description:
annexin A2 [Source:HGNC Symbol;Acc:537]
Mouse Orthologue:
Anxa2
Mouse Description:
annexin A2 Gene [Source:MGI Symbol;Acc:MGI:88246]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25237 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24716 Nonsense Available for shipment Available now
sa10952 Essential Splice Site Available for shipment Available now
sa38125 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa25237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011967 Essential Splice Site 48 337 4 13
Genomic Location (Zv9):
Chromosome 25 (position 35063815)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 33531578
KASP Assay ID:
554-7885.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTGCTATTATATTACAGTTTTGATAAATAAACATGGCTGTTTGTTTT[A/G]GGGGTGGATGAGCAAACCATAATTGACATCCTCACCAAACGGACATACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24716
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011967 Nonsense 137 337 6 13
Genomic Location (Zv9):
Chromosome 25 (position 35067144)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 33534907
KASP Assay ID:
554-5514.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACAGACGAAGAGTCTCTGATTGAGATCCTCTGCTCTCGAAGCAATGCT[G/T]AGATCATGGAGATCAAGAAAGTCTACAGGGAATGTGAGTATGGCAGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011967 Essential Splice Site 258 337 10 13
Genomic Location (Zv9):
Chromosome 25 (position 35069146)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 33536909
KASP Assay ID:
554-5516.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATYCGCAAAGAGGTCAAAGGAGAYCTAGAGAAGTCCTTCCTGACCCTCGG[T/G]GAGAGCCTTCATCTACAAACACCYCAKACAACTGACTTCTGATATCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011967 Essential Splice Site 277 337 11 13
Genomic Location (Zv9):
Chromosome 25 (position 35072106)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 33539869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAAACAAACAGCTGTATTTCGCCAGCAGACTGCAAGACGCCATGAAG[G/A]TAGAATAAGTTCTTCCGCTAACACCTTTATATGCGTTCCTGTGATTGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link