naa15a

Ensembl ID:
ENSDARG00000003213
ZFIN ID:
ZDB-GENE-030131-2392
Description:
N-alpha-acetyltransferase 15, NatA auxiliary subunit [Source:RefSeq peptide;Acc:NP_956940]
Human Orthologue:
NAA15
Human Description:
N(alpha)-acetyltransferase 15, NatA auxiliary subunit [Source:HGNC Symbol;Acc:30782]
Mouse Orthologue:
Naa15
Mouse Description:
N(alpha)-acetyltransferase 15, NatA auxiliary subunit Gene [Source:MGI Symbol;Acc:MGI:1922088]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11586 Nonsense Available for shipment Available now
sa15657 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017785 Nonsense 178 867 5 20
ENSDART00000124417 Nonsense 178 867 5 20
Genomic Location (Zv9):
Chromosome 14 (position 49064800)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47142459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAGATTATGAGATGGCGGCTAAGATCGTGGAGGAGTTTCGCAAAACT[C/T]AACAGGTACRCTCAGTTAATGATTTTCAGACAGATRATAGRGCAGNNACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017785 Nonsense 699 867 17 20
ENSDART00000124417 Nonsense 699 867 17 20
Genomic Location (Zv9):
Chromosome 14 (position 49083912)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47161571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTTGTAGAAAAGTATCTGCTGATGCTGCAGTCGGTGAAGAGAGCTTA[T/A]TCCCTGGACCCCGATCACCCGTGGCTCCACCAGTGTTTAGTGCGGTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link