mterfd1

Ensembl ID:
ENSDARG00000003207
ZFIN ID:
ZDB-GENE-040718-359
Description:
mTERF domain-containing protein 1, mitochondrial [Source:RefSeq peptide;Acc:NP_001002615]
Human Orthologue:
MTERFD1
Human Description:
MTERF domain containing 1 [Source:HGNC Symbol;Acc:24258]
Mouse Orthologue:
Mterfd1
Mouse Description:
MTERF domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913660]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17146 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17146
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006338 Essential Splice Site 211 402 4 8
Genomic Location:
Chromosome 19 (position 45566531)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAAGAACCCCTTCATCCTTRCGGAAAGCCTGGACAACCTTCAGGCCAG[G/A]TCAGAGAGCGAGATAAGCAAATGTATTAAACTTCTGMAAACTAKCCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8oe4kore