ngly1

Ensembl ID:
ENSDARG00000003205
ZFIN ID:
ZDB-GENE-050522-535
Description:
Peptide-N(4)-(N-acetyl-beta-glucosaminyl)asparagine amidase [Source:UniProtKB/Swiss-Prot;Acc:Q503I8]
Human Orthologue:
NGLY1
Human Description:
N-glycanase 1 [Source:HGNC Symbol;Acc:17646]
Mouse Orthologue:
Ngly1
Mouse Description:
N-glycanase 1 Gene [Source:MGI Symbol;Acc:MGI:1913276]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31033 Nonsense Mutation detected in F1 DNA During 2017
sa6554 Nonsense Mutation detected in F1 DNA During 2017
sa23506 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019206 Nonsense 292 644 6 11
Genomic Location (Zv9):
Chromosome 19 (position 21251767)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 21185147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCATTACGCAGGTACAATAACCCAGAGAAGCTTCTAGAGACCAGGAAA[G/T]GACGTTGTGGGGAATGGGCCAACTGTTTCACCCTGCTCTGCAGAGCCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6554
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019206 Nonsense 360 644 7 11
Genomic Location (Zv9):
Chromosome 19 (position 21248972)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 21182352
KASP Assay ID:
554-4620.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGATAAACCCCTCCTGTATGAAGTTGGCTGGGGCAAGAAACTCTCCTA[C/A]ATCCTGGCCTTCTCCAAGGATCAGGTGGCAGATGTRACGTGGAGATACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019206 Nonsense 575 644 10 11
Genomic Location (Zv9):
Chromosome 19 (position 21244438)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 21177818
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCGAGCCTTCAGTCAGACCTTCCATTCAGGCACTGTGCGTTGGAGTT[T/G]AAGTACCAACGAGACCACCACAGAATTCCCTGGAGGTATGAGACTCACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link