foxm1l

Ensembl ID:
ENSDARG00000003200
ZFIN ID:
ZDB-GENE-040426-1275
Description:
forkhead box protein M1 [Source:RefSeq peptide;Acc:NP_957391]
Human Orthologue:
FOXM1
Human Description:
forkhead box M1 [Source:HGNC Symbol;Acc:3818]
Mouse Orthologue:
Foxm1
Mouse Description:
forkhead box M1 Gene [Source:MGI Symbol;Acc:MGI:1347487]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10708 Nonsense Available for shipment Available now
sa40220 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10708
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008898 Nonsense 257 623 5 9
Genomic Location:
Chromosome 4 (position 5699327)
KASP Assay ID:
2259-4460.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCATCCGAGAAACATCTCCTGATGGCAAGATCTCCTATTGGAYGATT[C/T]GACCAGAAGCAAACCGCTGTCTCACTCTGGACCAAGTCTATAAGGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008898 Essential Splice Site 370 623 9 9
Genomic Location:
Chromosome 4 (position 5683327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGGCCTCTTAGTCTTGAGATGAGTTTGACGCTTGTGTGTTTTGTGAA[G/T]GTCTCTCAGAGCGACTTGAGCTCAGTGTTGCTGTGCAAACCTGCGCCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link