rassf7b

Ensembl ID:
ENSDARG00000003193
ZFIN ID:
ZDB-GENE-030429-1
Description:
Ras association (RalGDS/AF-6) domain family (N-terminal) member 7b [Source:RefSeq peptide;Acc:NP_92
Human Orthologue:
RASSF7
Human Description:
Ras association (RalGDS/AF-6) domain family (N-terminal) member 7 [Source:HGNC Symbol;Acc:1166]
Mouse Orthologue:
Rassf7
Mouse Description:
Ras association (RalGDS/AF-6) domain family (N-terminal) member 7 Gene [Source:MGI Symbol;Acc:MGI:19

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1126 Nonsense F2 line generated During 2017
sa21058 Nonsense Available for shipment Available now
sa41002 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1126
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025451 Nonsense 141 427 3 6
ENSDART00000131210 Nonsense 141 201 3 3
ENSDART00000137059 Nonsense 141 232 3 3
ENSDART00000141934   None 90 None 3

The following transcripts of ENSDARG00000003193 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 51138584)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49408820
KASP Assay ID:
554-1037.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCGAACTCGTGTGAAGCAGGTTGAAAAGCCACCTAAAGACTTCCAAGCA[C/T]GAGGTGCATCTCCATCGCCCTCTTTGTCACTTGCCCAAGCAGCTCCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21058
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025451 Nonsense 237 427 3 6
ENSDART00000131210   None 201 None 3
ENSDART00000137059   None 232 None 3
ENSDART00000141934   None 90 None 3

The following transcripts of ENSDARG00000003193 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 51138872)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49409108
KASP Assay ID:
2259-9424.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCATGCTAAGTTTTGGGAAGATGAGTTTCAGTCCGAGGTACAAAAAGAA[A/T]AGGACATCCTTCGGCAAAAAAATGAACTCAAAATTGCCCTAGATAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025451 Nonsense 421 427 6 6
ENSDART00000131210   None 201 None 3
ENSDART00000137059   None 232 None 3
ENSDART00000141934   None 90 None 3

The following transcripts of ENSDARG00000003193 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 51147379)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49417615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCCTCATTCCATTGTGTATGTGTGTGTGTGTCTTGCAGTCCTGTCAT[C/A]AAGAGAGACATCATGGCGATAAAGTCCGGACTGCGACACAAGGAATTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link