psmd1

Ensembl ID:
ENSDARG00000003189
ZFIN ID:
ZDB-GENE-040426-810
Description:
26S proteasome non-ATPase regulatory subunit 1 [Source:RefSeq peptide;Acc:NP_957478]
Human Orthologue:
PSMD1
Human Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 [Source:HGNC Symbol;Acc:9554]
Mouse Orthologue:
Psmd1
Mouse Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 Gene [Source:MGI Symbol;Acc:MGI:1917497]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32413 Essential Splice Site Available for shipment Available now
sa16735 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007346 Essential Splice Site 20 887 2 26
ENSDART00000144100 Essential Splice Site 15 959 1 24

The following transcripts of ENSDARG00000003189 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 40620878)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 37700793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGCTGGAATTATTTCCCTCCTGGATGAAGACGAGCCTCAGCTCAAGG[T/C]ACAGCAGGAACTCAAGCAAATATTCTGATACTTATTGTATCGACATTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16735
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007346 Nonsense 503 887 13 26
ENSDART00000144100 Nonsense 498 959 12 24

The following transcripts of ENSDARG00000003189 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 40637292)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 37717207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGCACCGCTCGCCAAGACGTCTAYGATCTGCTYAAATCAAACCTTTA[T/A]CAGGATGATGCAGTAACCGGTATGTCAAATATGCAWTCATTMATTTATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link