magi1

Ensembl ID:
ENSDARG00000003169
ZFIN ID:
ZDB-GENE-030131-5110
Description:
membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1 [Source:RefSeq peptide
Human Orthologues:
MAGIX, SAV1
Human Descriptions:
MAGI family member, X-linked [Source:HGNC Symbol;Acc:30006]
salvador homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:17795]
Mouse Orthologues:
Magix, Sav1
Mouse Descriptions:
MAGI family member, X-linked Gene [Source:MGI Symbol;Acc:MGI:1859644]
salvador homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1927144]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15448 Nonsense Available for shipment Available now
sa35064 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9078 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17306 Essential Splice Site Available for shipment Available now
sa16729 Essential Splice Site Available for shipment Available now
sa2611 Nonsense F2 line generated During 2016
sa41810 Nonsense Mutation detected in F1 DNA During 2016
sa24890 Nonsense Mutation detected in F1 DNA During 2016
sa35065 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044423   None 1276 None 24
ENSDART00000103968 Nonsense 263 293 5 5
ENSDART00000103969   None 1109 None 20
Genomic Location (Zv9):
Chromosome 11 (position 19439948)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18857262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGGAAGGAAAGGGGGAAAGAGCGCCATCTGGCTGTGGCGGAGRGGTT[T/A]GTTTGTGTTAGAAAGCAGCAAGATGGACTNNNNCTGTCCTTATGTATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044423 Essential Splice Site 359 1276 7 24
ENSDART00000103968   None 293 None 5
ENSDART00000103969 Essential Splice Site 221 1109 5 20
Genomic Location (Zv9):
Chromosome 11 (position 19449976)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18867290
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTGATGAGAAGAAGGGGTCCATACAGAGGAGCTGGACAATGAACTAG[G/A]TAGGCCACAATCCCACTGGGAAACTTTTTTTTAACTTGTAAACCCAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044423 Essential Splice Site 360 1276 7 24
ENSDART00000103968   None 293 None 5
ENSDART00000103969 Essential Splice Site 222 1109 5 20
Genomic Location (Zv9):
Chromosome 11 (position 19449977)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18867291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTGWTGAGAAGAAGGGGTCCATACAGAGGAGCTGGACAATGAACTAGG[T/G]AGGCCACAATCCCACTGGGAAACTTTTTTTTAACTTGTAAACCCAGCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17306
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044423 Essential Splice Site 360 1276 8 24
ENSDART00000103968   None 293 None 5
ENSDART00000103969 Essential Splice Site 222 1109 6 20
ENSDART00000044423 Essential Splice Site 360 1276 8 24
ENSDART00000103968   None 293 None 5
ENSDART00000103969 Essential Splice Site 222 1109 6 20
Genomic Location (Zv9):
Chromosome 11 (position 19458053)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18875367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGARTTACAATGAGCTGAAAAACCTYTTCTGTTTTGCTTCCTTTTTTCC[A/T]GAGCTGCCAACAGGCTGGGAGAAGATYGATGATCCAGTGTACGGGGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16729
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044423 Essential Splice Site 360 1276 8 24
ENSDART00000103968   None 293 None 5
ENSDART00000103969 Essential Splice Site 222 1109 6 20
ENSDART00000044423 Essential Splice Site 360 1276 8 24
ENSDART00000103968   None 293 None 5
ENSDART00000103969 Essential Splice Site 222 1109 6 20
Genomic Location (Zv9):
Chromosome 11 (position 19458053)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18875367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGARTTACAATGAGCTGAAAAACCTYTTCTGTTTTGCTTCCTTTTTTCC[A/T]GAGCTGCCAACAGGCTGGGAGAAGATYGATGATCCAGTGTACGGGGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2611
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044423 Nonsense 395 1276 9 24
ENSDART00000103968   None 293 None 5
ENSDART00000103969 Nonsense 257 1109 7 20
Genomic Location (Zv9):
Chromosome 11 (position 19458924)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18876238
KASP Assay ID:
554-3283.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTCATATTAACAGGAAGACGCAGTATGAGAACCCAATTCTGGAAGCT[A/T]AAAGGAAGAAGCAACTGGAGCAGTCTCAGCCCGCTGAAGGTGAGCGGWTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41810
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044423 Nonsense 527 1276 12 24
ENSDART00000103968   None 293 None 5
ENSDART00000103969 Nonsense 389 1109 10 20
Genomic Location (Zv9):
Chromosome 11 (position 19462152)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18879466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTATTGTAAGTGTGAACGACACTTGCGTTTTGGGTTACACACACGCC[C/T]AAGTTGTGAAGATCTTCCAGTCAATCCCTATTGGCTCTATGGTCGACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044423 Nonsense 666 1276 12 24
ENSDART00000103968   None 293 None 5
ENSDART00000103969 Nonsense 528 1109 10 20
Genomic Location (Zv9):
Chromosome 11 (position 19462569)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18879883
KASP Assay ID:
554-7673.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGGGATTCGGCTTCACAATAGCAGACAGCCCGTCTGGAGGAGGCCAG[C/T]GAGTAAAGCAGATAGTGGATTACCCACGATGCAGAGGCCTGAGGGAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044423 Nonsense 720 1276 12 24
ENSDART00000103968   None 293 None 5
ENSDART00000103969 Nonsense 582 1109 10 20
Genomic Location (Zv9):
Chromosome 11 (position 19462731)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18880045
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGCTCAGCAAGTGTCCTAAAGGCAGTGAAGTGACCATGTTGGTGCAA[C/T]GAGGTAAGCTCACCAAAATGTTATGACATGAAAGGAAAAGTGAGAAAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link