LOC794555

Ensembl ID:
ENSDARG00000003157
Human Orthologue:
NFKBIL1
Human Description:
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1 [Source:HGNC Sym
Mouse Orthologue:
Nfkbil1
Mouse Description:
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1 Gene [Source:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21653 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059017 Nonsense 164 360 3 4
Genomic Location:
Chromosome 10 (position 7068943)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGAAGCTTTTAGGAGAATGCCAGGATGAGTTTTTTGAGACATTCGGA[C/T]AGTTTGATGGCAAGTGTTGTATTTTCTGTTGCATCTTGTACAGTTACTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Neonatal lupus: Identification of candidate loci at 6p21 and 21q22 in a genome-wide association study of cardiac manifestations of neonatal lupus. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8lghdyhz