ENSDARG00000003145

Ensembl ID:
ENSDARG00000003145
Human Orthologues:
AP000926.1, C1orf204
Human Descriptions:
Adipocyte adhesion molecule [Source:UniProtKB/Swiss-Prot;Acc:Q9H6B4]
chromosome 1 open reading frame 204 [Source:HGNC Symbol;Acc:27647]
Mouse Orthologue:
9030425E11Rik
Mouse Description:
RIKEN cDNA 9030425E11 gene Gene [Source:MGI Symbol;Acc:MGI:1918816]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21798 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009857 Nonsense 20 398 2 8
Genomic Location:
Chromosome 10 (position 41445945)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTTTCTCTCTCCGCAGTATTGCTGAATGTGCTTCAGGCAAACGGC[C/T]AGACGGAGATGAAGAGGGTGGTCGGAGACAACGCCACGCTGCCCTGCCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/de6efja7