dachc

Ensembl ID:
ENSDARG00000003142
ZFIN ID:
ZDB-GENE-020402-5
Description:
dachshund c [Source:RefSeq peptide;Acc:NP_001038701]
Human Orthologue:
DACH1
Human Description:
dachshund homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:2663]
Mouse Orthologue:
Dach1
Mouse Description:
dachshund 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1277991]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24849 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24849
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018827 Nonsense 185 591 2 11

The following transcripts of ENSDARG00000003142 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 29705447)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29845259
KASP Assay ID:
554-7379.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACCGAAAGGAAGTGCTTGTCTGATATCTGATGTTCATCTTTCAGCTCC[A/T]GACCTGGCAGACCTCCTAAAAGGACCCAGAATGTGACATCACCCGACAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link