kdm5bb

Ensembl ID:
ENSDARG00000003098
ZFIN ID:
ZDB-GENE-030424-1
Description:
Lysine-specific demethylase 5B-B [Source:UniProtKB/Swiss-Prot;Acc:Q6IQX0]
Human Orthologue:
KDM5B
Human Description:
lysine (K)-specific demethylase 5B [Source:HGNC Symbol;Acc:18039]
Mouse Orthologue:
Kdm5b
Mouse Description:
lysine (K)-specific demethylase 5B Gene [Source:MGI Symbol;Acc:MGI:1922855]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10483 Nonsense Available for shipment Available now
sa11572 Nonsense Available for shipment Available now
sa14544 Nonsense Available for shipment Available now
sa21313 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005583 Nonsense 315 1522 9 28
ENSDART00000108508 Nonsense 296 1503 8 27
Genomic Location:
Chromosome 8 (position 29183696)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATATATAAATATGKCATGTGATTTATYCGKCTATAGGTGGACCTCTA[T/A]GTGTGTTTAGTGTGTGGAAAGGGAAACGACGAGGATCGGTTGTTGCTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11572
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005583 Nonsense 382 1522 10 28
ENSDART00000108508 Nonsense 363 1503 9 27
Genomic Location:
Chromosome 8 (position 29183321)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGTAAACCTCAGGAGGCATTTGGCTTCGAGCAAGCACACAGAGACTA[T/A]ACTCTYAAAGCCTTTGGGGAAATGGCAGACTCCTTCAAGTCAGATTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14544
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005583 Nonsense 661 1522 15 28
ENSDART00000108508 Nonsense 642 1503 14 27
Genomic Location:
Chromosome 8 (position 29180518)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCTGACTGTCTTGATGTGGTTCTGGCGTCAGCCGTACAGAAGGACATG[C/T]AGCTCATGATCAAAGAAGAGAGAGAGCTGCGGGAGAAAGTCCGWAAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21313
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005583 Nonsense 1361 1522 26 28
ENSDART00000108508 Nonsense 1342 1503 25 27
Genomic Location:
Chromosome 8 (position 29166195)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTCTCAGTCCAGAGCTGGAGGAGCTGATGGTGGAGGGTTTGGTCCTG[C/T]AGGTTTCTTTGCCTGAGACCCAGCAGCTCTACAGGCTTCTGCTGTCTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tipp7k7p