oclnb

Ensembl ID:
ENSDARG00000003091
ZFIN ID:
ZDB-GENE-041212-43
Description:
occludin b [Source:RefSeq peptide;Acc:NP_001008618]
Human Orthologue:
OCLN
Human Description:
occludin [Source:HGNC Symbol;Acc:8104]
Mouse Orthologue:
Ocln
Mouse Description:
occludin Gene [Source:MGI Symbol;Acc:MGI:106183]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20421 Nonsense Available for shipment Available now
sa20422 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20421
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007247 Nonsense 170 468 3 9
ENSDART00000098514 Nonsense 163 461 4 10
ENSDART00000134432 Nonsense 170 471 3 9

The following transcripts of ENSDARG00000003091 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 27859105)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25614403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATCCTGGTGGTGTCGAGACAGAGCAGTTCCCAGTCTCCCAAATTCTA[T/A]CTGGCCACCATCATTATTTGTGCCATTCTGGCTGCACTCATGCTCATCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007247 Nonsense 420 468 7 9
ENSDART00000098514 Nonsense 413 461 8 10
ENSDART00000134432 Nonsense 423 471 7 9

The following transcripts of ENSDARG00000003091 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 27862839)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25618137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGGCAGATGCAGATCGAGAGCTCGACAGGCTAGAGGAAGGCAGCCCA[C/T]AGTTCATGGTATGTAATTTAGGAGACAACAGTTGCCTTAAAGTTTAGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link