LOC570542

Ensembl ID:
ENSDARG00000003085
Human Orthologue:
STAMBPL1
Human Description:
STAM binding protein-like 1 [Source:HGNC Symbol;Acc:24105]
Mouse Orthologue:
Stambpl1
Mouse Description:
STAM binding protein like 1 Gene [Source:MGI Symbol;Acc:MGI:1923880]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42003 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106035 Essential Splice Site 286 420 7 10
Genomic Location (Zv9):
Chromosome 12 (position 18194114)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17004691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAAAATCTGTGTTTTGAAATCTTAAAATCTGTGTTTTGTTGTCCCCC[A/G]GACACATAATGAGTTTGTGCTGACTCACGTGATCGTCCCAAAGCAGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link