gorasp1

Ensembl ID:
ENSDARG00000003068
ZFIN ID:
ZDB-GENE-030826-23
Description:
Golgi reassembly-stacking protein 1 [Source:RefSeq peptide;Acc:NP_001007412]
Human Orthologue:
GORASP1
Human Description:
golgi reassembly stacking protein 1, 65kDa [Source:HGNC Symbol;Acc:16769]
Mouse Orthologue:
Gorasp1
Mouse Description:
golgi reassembly stacking protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921748]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6841 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32917 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024619 Essential Splice Site 49 438 2 9
ENSDART00000131030 Essential Splice Site 49 461 2 9
Genomic Location (Zv9):
Chromosome 2 (position 24054600)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24153895
KASP Assay ID:
554-5105.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGAGCCCTTTTTTGATTTCATCATATCTATTGGCCATAACCGCCTTG[T/C]AAGTTTGTTGGATTGGGCAGTTTTTGTTTYGCACAAAGGTTTATTTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024619 Essential Splice Site 190 438 5 9
ENSDART00000131030 Essential Splice Site 190 461 5 9
Genomic Location (Zv9):
Chromosome 2 (position 24052551)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24155944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGGAGGTCATTGTTACACCAAATGGTGCCTGGGGGGGAGAAGGAAGG[T/A]ATTGACACTGTTACTAATGATATAAAACTGTAATGATTGTTATGTTTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link