cd276

Ensembl ID:
ENSDARG00000003061
ZFIN ID:
ZDB-GENE-070112-452
Description:
CD276 molecule [Source:RefSeq peptide;Acc:NP_001074091]
Human Orthologue:
CD276
Human Description:
CD276 molecule [Source:HGNC Symbol;Acc:19137]
Mouse Orthologue:
Cd276
Mouse Description:
CD276 antigen Gene [Source:MGI Symbol;Acc:MGI:2183926]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1379 Nonsense Available for shipment Available now
sa2948 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa1379
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033591 Nonsense 98 300 2 6
Genomic Location:
Chromosome 18 (position 49356438)
KASP Assay ID:
554-1291.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCGGCCGCACCACGCTGTTTTCGGATCAGCTGATGGTTGGAAATGCCT[C/A]GCTKCGCATTAGGAAAGTGCGCGTGGCAGATGAGGGAACGTACTCCTGCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa2948
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033591 Essential Splice Site 293 300 5 6
Genomic Location:
Chromosome 18 (position 49313178)
KASP Assay ID:
554-2448.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGCAAAAGARCTGGAGGAAGCCAGAGTATTAGAAGAAGCCAAATCAG[G/A]TCAGTGGCAGATGATATTGCTCATATTCCTCCATACATCACTCCACTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bg09y9ez