fgfr1op

Ensembl ID:
ENSDARG00000003058
ZFIN ID:
ZDB-GENE-090417-1
Description:
FGFR1 oncogene partner [Source:RefSeq peptide;Acc:NP_001002125]
Human Orthologue:
FGFR1OP
Human Description:
FGFR1 oncogene partner [Source:HGNC Symbol;Acc:17012]
Mouse Orthologue:
Fgfr1op
Mouse Description:
Fgfr1 oncogene partner Gene [Source:MGI Symbol;Acc:MGI:1922546]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43468 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23732 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010494 Essential Splice Site 140 511 5 19

The following transcripts of ENSDARG00000003058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 30609028)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30680241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGTGAAAAGGGGACGACACAGGGAAAAGACCTCCATTTTCACAGAG[G/A]TGACCTTTAATGAGCTGCATTTCAGCCAGTCAGATCAGTCCCCTGCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23732
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010494 Nonsense 452 511 17 19

The following transcripts of ENSDARG00000003058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 30631756)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30702969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTCTTTTCATTTCCAAACAAATGCTTTGCAGATGATGATCTTGACTA[T/A]GATGACGACTTCAACAGGTAAATACATTGTCCGACTAGTGTTTTGCAGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Graves' disease: A genome-wide association study identifies two new risk loci for Graves' disease. (View Study)
  • Vitiligo: Genome-wide association study for vitiligo identifies susceptibility loci at 6q27 and the MHC. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link