scnm1

Ensembl ID:
ENSDARG00000003027
ZFIN ID:
ZDB-GENE-030131-415
Description:
Sodium channel modifier 1 [Source:UniProtKB/Swiss-Prot;Acc:Q2YDS5]
Human Orthologue:
SCNM1
Human Description:
sodium channel modifier 1 [Source:HGNC Symbol;Acc:23136]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42749 Nonsense Mutation detected in F1 DNA During 2017
sa14725 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42749
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004284 Nonsense 98 249 4 8
ENSDART00000132351 Nonsense 96 247 4 8

The following transcripts of ENSDARG00000003027 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 31934983)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29754346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGCGACGCGAAATTGATAAAAGAAGACATCAAGACTATGTCAAAGCA[G/T]AAGATGATCGACAGGTGATTCAATGTGTTTTCTTTGATCACTTTATCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14725
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004284 Nonsense 101 249 4 8
ENSDART00000132351 Nonsense 99 247 4 8

The following transcripts of ENSDARG00000003027 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 31934974)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29754337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGAAATTGATAAAAGAAGACAWCAAGACTATGTCAAAGCAGAAGATGAT[C/T]GACAGGTKATTCAATGTGTTTTCTTTGATCACTTTATCTAAWCGTGCAYC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link