hdac8

Ensembl ID:
ENSDARG00000003021
ZFIN ID:
ZDB-GENE-040426-2772
Description:
Histone deacetylase 8 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXM0]
Human Orthologue:
PHKA1
Human Description:
phosphorylase kinase, alpha 1 (muscle) [Source:HGNC Symbol;Acc:8925]
Mouse Orthologue:
Phka1
Mouse Description:
phosphorylase kinase alpha 1 Gene [Source:MGI Symbol;Acc:MGI:97576]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38642 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14948 Nonsense Available for shipment Available now
sa31597 Nonsense Mutation detected in F1 DNA During 2016
sa10754 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38642
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009184   None 378 None 11
ENSDART00000083190 Essential Splice Site 970 1376 26 39
ENSDART00000108984   None 378 None 12
ENSDART00000136047   None 279 None 8

The following transcripts of ENSDARG00000003021 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 53176073)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTTCACCACATTCTGAGCGGAAAAGAATTCGGTGTTCAGAGAAGTGG[T/C]GAGTGACTTCATGAGAATTACTGGGCTTTAAGGGCAGTGTTTCTCAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009184 Nonsense 155 378 5 11
ENSDART00000083190 Nonsense 1153 1376 33 39
ENSDART00000108984 Nonsense 155 378 5 12
ENSDART00000136047 Nonsense 56 279 2 8

The following transcripts of ENSDARG00000003021 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 53160613)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATTGAATGTGTGTTGTTATATAAGGGACGAGGCATCTGGCTTCTGTTA[T/A]GTGAATGACGCGGTTCTTGGAATCCTCAAACTTCGGGAGAAGTATGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009184 Nonsense 297 378 8 11
ENSDART00000083190 Nonsense 1295 1376 36 39
ENSDART00000108984 Nonsense 297 378 8 12
ENSDART00000136047 Nonsense 198 279 5 8

The following transcripts of ENSDARG00000003021 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 53153442)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTCTGTTGGAGTCGCAAAGTGTCTAACCTATATACTTGGCTGGGAGT[T/A]ACCTACTTTGCTACTAGGAGGAGGTGCGTGTTATTGCTTTTGTTAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009184 Nonsense 307 378 9 11
ENSDART00000083190 Nonsense 1305 1376 37 39
ENSDART00000108984 Nonsense 307 378 9 12
ENSDART00000136047 Nonsense 208 279 6 8

The following transcripts of ENSDARG00000003021 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 53148730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACTCACTGTATATACAAATCTGCCTCTCTCTCCTTTCTCAGGCGGCTA[T/A]AACCTTGCCAATACTGCCCGCTGCTGGACCTATCTAACGGGGACCGTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link