hdac8

Ensembl ID:
ENSDARG00000003021
ZFIN ID:
ZDB-GENE-040426-2772
Description:
Histone deacetylase 8 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXM0]
Human Orthologue:
PHKA1
Human Description:
phosphorylase kinase, alpha 1 (muscle) [Source:HGNC Symbol;Acc:8925]
Mouse Orthologue:
Phka1
Mouse Description:
phosphorylase kinase alpha 1 Gene [Source:MGI Symbol;Acc:MGI:97576]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14948 Nonsense Available for shipment Available now
sa10754 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009184 Nonsense 155 378 5 11
ENSDART00000083190 Nonsense 1153 1376 33 39
ENSDART00000108984 Nonsense 155 378 5 12
ENSDART00000136047 Nonsense 56 279 2 8

The following transcripts of ENSDARG00000003021 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 53160613)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATTGAATGTGTGTTGTTATATAAGGGACGAGGCATCTGGCTTCTGTTA[T/A]GTGAATGACGCGGTTCTTGGAATCCTCAAACTTCGGGAGAAGTATGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009184 Nonsense 307 378 9 11
ENSDART00000083190 Nonsense 1305 1376 37 39
ENSDART00000108984 Nonsense 307 378 9 12
ENSDART00000136047 Nonsense 208 279 6 8

The following transcripts of ENSDARG00000003021 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 53148730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACTCACTGTATATACAAATCTGCCTCTCTCTCCTTTCTCAGGCGGCTA[T/A]AACCTTGCCAATACTGCCCGCTGCTGGACCTATCTAACGGGGACCGTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ejyf3mo4