lrrc4.2

Ensembl ID:
ENSDARG00000003020
ZFIN ID:
ZDB-GENE-030131-7997
Description:
leucine rich repeat containing 4 [Source:RefSeq peptide;Acc:NP_001093494]
Human Orthologue:
LRRC4
Human Description:
leucine rich repeat containing 4 [Source:HGNC Symbol;Acc:15586]
Mouse Orthologue:
Lrrc4
Mouse Description:
leucine rich repeat containing 4 Gene [Source:MGI Symbol;Acc:MGI:2182081]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23240 Nonsense Mutation detected in F1 DNA During 2014
sa23239 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007520 Nonsense 5 644 1 1
Genomic Location:
Chromosome 18 (position 9758776)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCACACGATGTTGAATTATGAACGCGCCACATCATGAGTCTCTTGTG[G/A]CAGGTAACTGTGCACCGTGCCTGGAACGCAGCCCTGCTCTGTGCAGTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007520 Nonsense 598 644 1 1
Genomic Location:
Chromosome 18 (position 9756999)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTACCTAGCCTGAGAGATCACAACAGCACCTACAAACCCAGCTCCTAC[A/T]GACCAGCACACTCTGCTCCCTGGGCAGAGAACAACATTGGTAACTCCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8dh8hmjn