eef2b

Ensembl ID:
ENSDARG00000003016
ZFIN ID:
ZDB-GENE-030131-5128
Description:
eukaryotic translation elongation factor 2b [Source:RefSeq peptide;Acc:NP_956752]
Human Orthologue:
EEF2
Human Description:
eukaryotic translation elongation factor 2 [Source:HGNC Symbol;Acc:3214]
Mouse Orthologue:
Eef2
Mouse Description:
eukaryotic translation elongation factor 2 Gene [Source:MGI Symbol;Acc:MGI:95288]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19909 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023931 Essential Splice Site 689 858 10 13
Genomic Location (Zv9):
Chromosome 2 (position 56967581)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 56952474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGATCAAGGACAGCGTCGTGGCTGGATTCCAGTGGGCCACAAAAGAGG[T/C]GAGGAGGAGATTGGAGTTATTTTATTTTCTACTTTTTGACTGACTGATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link