si:dkey-12m15.4

Ensembl ID:
ENSDARG00000002981
ZFIN IDs:
ZDB-GENE-040625-72, ZDB-GENE-100922-21
Description:
hypothetical protein LOC415182 [Source:RefSeq peptide;Acc:NP_001002092]
Human Orthologues:
AC008537.2, CYP2A7P1
Human Description:
cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 [Source:HGNC Symbol;Acc:2612]
Mouse Orthologues:
Cyp2ab1, Cyp2j13
Mouse Descriptions:
cytochrome P450, family 2, subfamily ab, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3644957]
cytochrome P450, family 2, subfamily j, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:2385197]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24408 Essential Splice Site Available for shipment Available now
sa44053 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24408
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045049 Essential Splice Site 116 499 2 9
ENSDART00000050571   None 69 None 1
ENSDART00000102944 Essential Splice Site 42 425 2 9
Genomic Location (Zv9):
Chromosome 23 (position 42953663)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42397296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGGAAGACCATGTCTGCCGGTTATAGACTGGACTTCTAATGGATGCG[G/A]TCAGTAACACTTTTCTTAATCAAGCTCCAAAAAATAATTCTCAAAGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045049 Nonsense 484 499 9 9
ENSDART00000050571   None 69 None 1
ENSDART00000102944   None 425 None 9
Genomic Location (Zv9):
Chromosome 23 (position 42944168)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42406791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGATGCAAAGCCCTTAGACATGGATGGCATCGTGGGTATAGTCCGCTA[T/A]CCTCAAACCTTTAGCATCATCTGCTGCAGTAGAGACAGCAAAAAGTGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link