ITGAM

Ensembl ID:
ENSDARG00000002956
Description:
integrin, alpha M (complement component 3 receptor 3 subunit) [Source:HGNC Symbol;Acc:6149]
Human Orthologues:
ITGAD, ITGAM, ITGAX
Human Descriptions:
integrin, alpha D [Source:HGNC Symbol;Acc:6146]
integrin, alpha M (complement component 3 receptor 3 subunit) [Source:HGNC Symbol;Acc:6149]
integrin, alpha X (complement component 3 receptor 4 subunit) [Source:HGNC Symbol;Acc:6152]
Mouse Orthologues:
Itgad, Itgam, Itgax
Mouse Descriptions:
integrin alpha M Gene [Source:MGI Symbol;Acc:MGI:96607]
integrin alpha X Gene [Source:MGI Symbol;Acc:MGI:96609]
integrin, alpha D Gene [Source:MGI Symbol;Acc:MGI:3578624]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6230 Nonsense Mutation detected in F1 DNA During 2017
sa7367 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025912 Nonsense 228 1145 7 31
Genomic Location (Zv9):
Chromosome 12 (position 4803051)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4085773
KASP Assay ID:
554-5241.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAACAAGTCAAAAACCCTGCCTGGTGGCAAAGAGCAGTGAATGGGATA[C/T]AACAAACACATGGATGGACTTTCACTGCAACAGCTATAAGACTGCTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7367
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025912 Missense 578 1145 16 31
Genomic Location (Zv9):
Chromosome 12 (position 4813271)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4095993
KASP Assay ID:
554-4367.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCACTGTGTCTAATGGCAGAGGATTGCTGGATCATCTGTGCAGTCAG[G/A]ATTGCAGTACTTTGGTGTTTCMTTRAGTCAATCYTCTCCAGACCAGACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link