ppp6c

Ensembl ID:
ENSDARG00000002949
ZFIN ID:
ZDB-GENE-040426-949
Description:
serine/threonine-protein phosphatase 6 catalytic subunit [Source:RefSeq peptide;Acc:NP_957299]
Human Orthologue:
PPP6C
Human Description:
protein phosphatase 6, catalytic subunit [Source:HGNC Symbol;Acc:9323]
Mouse Orthologue:
Ppp6c
Mouse Description:
protein phosphatase 6, catalytic subunit Gene [Source:MGI Symbol;Acc:MGI:1915107]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11395 Essential Splice Site Available for shipment Available now
sa7567 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11395
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007458 Essential Splice Site 127 305 None 7

The following transcripts of ENSDARG00000002949 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33622118)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31384350
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGGCAATCACGAGAGTAGGCAGATTACACAGGTYTATGGCTTTTATGG[T/C]AAGGCTGCAGAAATCAGAGATNNNTTTGAAATATTTTGTTTTKAATTTACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007458 Missense 220 305 6 7

The following transcripts of ENSDARG00000002949 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33631409)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31393641
KASP Assay ID:
554-4015.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTGGGCTATCAGTCCAAGAGGAGCTGGCTGGCTGTTTGGTGCTAAGG[T/G]CACTAATGAGGTAAAAATCGCTCTCAAARTGCACAGTCTGCNTTTGTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link