abcd3b

Ensembl ID:
ENSDARG00000002947
ZFIN ID:
ZDB-GENE-050517-29
Description:
ATP-binding cassette, sub-family D (ALD), member 3b [Source:RefSeq peptide;Acc:NP_001124092]
Human Orthologue:
ABCD3
Human Description:
ATP-binding cassette, sub-family D (ALD), member 3 [Source:HGNC Symbol;Acc:67]
Mouse Orthologue:
Abcd3
Mouse Description:
ATP-binding cassette, sub-family D (ALD), member 3 Gene [Source:MGI Symbol;Acc:MGI:1349216]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19701 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005643 Essential Splice Site 441 659 15 23
Genomic Location:
Chromosome 2 (position 14936903)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTTATCCCCGGGAGAGGTGAAATCATCATTGCAGACAATAAAATCAA[G/T]TAAATTACCAAGCAAACATCCACCAAGCCATCATAGTAACCTACTTAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s9lq5478