abcd3b

Ensembl ID:
ENSDARG00000002947
ZFIN ID:
ZDB-GENE-050517-29
Description:
ATP-binding cassette, sub-family D (ALD), member 3b [Source:RefSeq peptide;Acc:NP_001124092]
Human Orthologue:
ABCD3
Human Description:
ATP-binding cassette, sub-family D (ALD), member 3 [Source:HGNC Symbol;Acc:67]
Mouse Orthologue:
Abcd3
Mouse Description:
ATP-binding cassette, sub-family D (ALD), member 3 Gene [Source:MGI Symbol;Acc:MGI:1349216]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32865 Nonsense Mutation detected in F1 DNA During 2016
sa19701 Essential Splice Site Available for shipment Available now
sa39791 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32864 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005643 Nonsense 391 659 14 23
Genomic Location (Zv9):
Chromosome 2 (position 14937710)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15448537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTGTGTGTTTTATCTGGGATCTCCATCCATTTGTTAGGTTCACTGCA[C/T]GAATCACAGAAATACAAGAAGTCCTGAAGGAGCTGAATTCGGGAAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005643 Essential Splice Site 441 659 15 23
Genomic Location (Zv9):
Chromosome 2 (position 14936903)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15447730
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTTATCCCCGGGAGAGGTGAAATCATCATTGCAGACAATAAAATCAA[G/T]TAAATTACCAAGCAAACATCCACCAAGCCATCATAGTAACCTACTTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005643 Essential Splice Site 488 659 17 23
Genomic Location (Zv9):
Chromosome 2 (position 14935173)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15446000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCCCTAACGGATGTGGCAAGAGTTCCCTCTTCAGAGTCCTAGGAGAG[G/A]TTTGCACTAGAAATATGACTAGCTTTACAAACCATTGAGATTTGTTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005643 Essential Splice Site 580 659 20 23
Genomic Location (Zv9):
Chromosome 2 (position 14932514)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15443341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGACTGGATGGACGTCCTCAGTGGAGGAGAGAAGCAGAGGATGGCTG[T/C]AAGATCAACTCTCCAAACCGGACACATTGCTGTCTTTTTGGTGGGTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link