gbx2

Ensembl ID:
ENSDARG00000002933
ZFIN ID:
ZDB-GENE-020509-2
Description:
homeobox protein GBX-2 [Source:RefSeq peptide;Acc:NP_694496]
Human Orthologue:
GBX2
Human Description:
gastrulation brain homeobox 2 [Source:HGNC Symbol;Acc:4186]
Mouse Orthologue:
Gbx2
Mouse Description:
gastrulation brain homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:95668]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
e30 Nonsense Confirmed mutation in F2 line Unknown
sa40660 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
e30
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015333 Nonsense 68 342 1 2
Genomic Location (Zv9):
Chromosome 6 (position 15949601)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15904859
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCAGTGGTGCTTCCTCCGCCGCCTCCTCCACCCCCTCCAACACTCCCC[C/T]AAAGCGCTCTCCCTACGACCCATCCGCACCACCCGATCCCGGGCTTACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015333 Nonsense 307 342 2 2
Genomic Location (Zv9):
Chromosome 6 (position 15951321)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15906579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACCGGAGAGCCAAGTGGAAACGGGTCAAAGCGGGCAACGTCAACAGC[A/T]AAACCGGAGAGCCATCCAGAAACCCCAAAATTGTGGTGCCCATTCCGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link