si:dkey-102c8.6

Ensembl ID:
ENSDARG00000002917
ZFIN ID:
ZDB-GENE-050208-408
Description:
hypothetical protein LOC556445 [Source:RefSeq peptide;Acc:NP_001077294]
Human Orthologue:
GLS2
Human Description:
glutaminase 2 (liver, mitochondrial) [Source:HGNC Symbol;Acc:29570]
Mouse Orthologue:
Gls2
Mouse Description:
glutaminase 2 (liver, mitochondrial) Gene [Source:MGI Symbol;Acc:MGI:2143539]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32379 Nonsense Available for shipment Available now
sa39358 Essential Splice Site Mutation detected in F1 DNA During 2017
sa29725 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30726 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32379
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031005 Nonsense 113 542 4 18
ENSDART00000147580 Nonsense 197 627 4 18
Genomic Location (Zv9):
Chromosome 22 (position 10217271)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10077439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCATTTGTGGACATCATCAATCACATTTATTACACATCAAAACTGCAA[C/T]AAGATGGACAGGTAAGATGTGTATTTTATTACCTCACTTTATGTACTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39358
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031005 Essential Splice Site 247 542 9 18
ENSDART00000147580 Essential Splice Site 332 627 9 18
Genomic Location (Zv9):
Chromosome 22 (position 10214785)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10074953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTAAGAAGATGACAGGCAGTGAGTACGTGGGCTTCAGCAACGCAAC[G/A]TATGTCTTATTAGTTTGATATTCTAAGCTTGTTTCCACCTGTTGACTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031005 Essential Splice Site 441 542 15 18
ENSDART00000147580 Essential Splice Site 526 627 15 18
Genomic Location (Zv9):
Chromosome 22 (position 10209694)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10069862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATCTGATGTTTGCGGCCCACAGTGGAGATGTTTCAGCTCTGAGGAGG[T/G]TACTTTATGCCACTCTCAACTTTTTCACTGTCAGTTTCTGACTGCTACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30726
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031005 Essential Splice Site 488 542 None 18
ENSDART00000147580 Essential Splice Site 573 627 None 18
Genomic Location (Zv9):
Chromosome 22 (position 10209123)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10069291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTTACCTTTAGCTAATCCATCAGATCTAAAACTAACCTCTGTCATTC[A/G]GGTGGGGAAATATTCCTCGAGACGATGCCATGCAGTTCGGGCAAAAGGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link