sec31b

Ensembl ID:
ENSDARG00000002916
ZFIN ID:
ZDB-GENE-060418-2
Human Orthologue:
SEC31B
Human Description:
SEC31 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:23197]
Mouse Orthologue:
Sec31b
Mouse Description:
Sec31 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2685187]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42099 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42098 Nonsense Mutation detected in F1 DNA During 2017
sa873 Essential Splice Site Available for shipment Available now
sa10739 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014190 Essential Splice Site 27 1171 1 27
Genomic Location (Zv9):
Chromosome 12 (position 49760449)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48483822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAGGCGTGGAGTCCTGCCAGACAACACCCGGCCTACCTGGCCTTAGG[T/C]AAGAGTGTGTGTGTGTGTGTGTTGTATGATTGTATGTTTGTGTAACACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014190 Nonsense 133 1171 3 27
Genomic Location (Zv9):
Chromosome 12 (position 49752577)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48475950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTAATAAACACACGGGACCTGTTCGAGCCCTCGACTTCAACCGCTTT[C/T]AGGTAAGCCATATCAACCCATATGATTAGCTTCAGTATATCATTCATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014190 Essential Splice Site 260 1171 6 27
Genomic Location (Zv9):
Chromosome 12 (position 49747188)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48470561
KASP Assay ID:
554-0775.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCTTCGGTTCGCAACATCACCTCTAAAAGTGCTGGAGAACCACACCAG[G/A]TAGAGAAACCCGCATTTCTACTCAACATTAATAATATCACATCATTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014190 Nonsense 578 1171 14 27
Genomic Location (Zv9):
Chromosome 12 (position 49736732)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48460105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTGTATGTCTATTTTGTTACTAYCTGTGTGTGCAGATACAGACGGTT[T/A]GATCAGTCAGGCGCTGTTAGTGGGAAACTTCGAGGGCGCTGTGGATCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Stearic acid (18:0) plasma levels: Genome-wide association study identifies novel loci associated with concentrations of four plasma phospholipid fatty acids in the de novo lipogenesis pathway: results from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link