tjp3

Ensembl ID:
ENSDARG00000002909
ZFIN ID:
ZDB-GENE-030828-10
Description:
tight junction protein 3 [Source:RefSeq peptide;Acc:NP_958902]
Human Orthologue:
TJP3
Human Description:
tight junction protein 3 (zona occludens 3) [Source:HGNC Symbol;Acc:11829]
Mouse Orthologue:
Tjp3
Mouse Description:
tight junction protein 3 Gene [Source:MGI Symbol;Acc:MGI:1351650]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17625 Essential Splice Site Available for shipment Available now
sa4998 Nonsense Mutation detected in F1 DNA During 2014
sa15182 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012336 None None 506 None 10
ENSDART00000128397 Essential Splice Site 216 1255 5 30
ENSDART00000137995 None None 825 None 20
ENSDART00000139911 Essential Splice Site 244 294 6 7
ENSDART00000147070 Essential Splice Site 216 480 6 14
Genomic Location:
Chromosome 22 (position 17898788)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGCTGCCAAAGAAGGCTCGCTTCAGGAGGGAGATCTGGTTTTAAAGG[T/G]GAACAGCAGATTCTCAAATCAAATCACTTTTATTATCACATMATCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012336 None None 506 None 10
ENSDART00000128397 Nonsense 643 1255 20 30
ENSDART00000137995 Nonsense 213 825 10 20
ENSDART00000139911 None None 294 None 7
ENSDART00000147070 None None 480 None 14
Genomic Location:
Chromosome 22 (position 17887795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTCCGATCAGAACCATATCAGCTTTGTGAAGGAAGGCAGTGTCGGCT[T/A]GAGACTTGTGGGAGGAAATGATGTTGGCATCTTTGTCGGTGGTGTCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012336 Nonsense 492 506 10 10
ENSDART00000128397 Nonsense 1241 1255 30 30
ENSDART00000137995 Nonsense 811 825 20 20
ENSDART00000139911 None None 294 None 7
ENSDART00000147070 None None 480 None 14
Genomic Location:
Chromosome 22 (position 17882054)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGGAAGCGACAGTGACAGCGACGAAAACGACAGAGATGAAGACGAATA[T/G]GACGAAGCAGAAGACATTGAATGGGGAYCTGCTACAGAGCTGTAAWATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mzmkx43f