DGKA (2 of 2)

Ensembl ID:
ENSDARG00000002898
Description:
diacylglycerol kinase, alpha 80kDa [Source:HGNC Symbol;Acc:2849]
Human Orthologue:
DGKA
Human Description:
diacylglycerol kinase, alpha 80kDa [Source:HGNC Symbol;Acc:2849]
Mouse Orthologue:
Dgka
Mouse Description:
diacylglycerol kinase, alpha Gene [Source:MGI Symbol;Acc:MGI:102952]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38819 Nonsense Mutation detected in F1 DNA During 2017
sa16107 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009863 Nonsense 482 785 20 29
Genomic Location (Zv9):
Chromosome 11 (position 2470658)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2422990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACGTCTGCGTGTTTCAGGCTGCAGTTCTTCCAGAATCTTCAGGCGTTC[A/T]GAGTGCTGGTGTGTGGAGGAGACGGCACTGTGGGCTGGGTTTTAGATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009863 Essential Splice Site 499 785 20 29
Genomic Location (Zv9):
Chromosome 11 (position 2470603)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2422935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGTGTGTGGAGGAGACGGCACTGTGGGCTGGGTTTTAGATGCTATTG[G/A]TGAGAAACTTGCAGTTTGCAACTGAAATAGTKATATGGACGGCATCACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Vitiligo: Association analyses identify three susceptibility Loci for vitiligo in the Chinese Han population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link