aven

Ensembl ID:
ENSDARG00000002894
ZFIN ID:
ZDB-GENE-041001-171
Description:
cell death regulator aven-like [Source:RefSeq peptide;Acc:NP_001038757]
Human Orthologue:
AVEN
Human Description:
apoptosis, caspase activation inhibitor [Source:HGNC Symbol;Acc:13509]
Mouse Orthologue:
Aven
Mouse Description:
apoptosis, caspase activation inhibitor Gene [Source:MGI Symbol;Acc:MGI:1921518]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3101 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019759 Essential Splice Site 122 322 2 6
ENSDART00000147064 Essential Splice Site 122 257 2 5
Genomic Location:
Chromosome 20 (position 29258982)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCCTGYACAGAGAGGCACAGACTATCACGTCCTCCTCACATCAGCTGG[T/C]AAGACCTGAATGTTCACTTAAATCTGTGTTATTTTTCTTCCCATGTCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7vh8cpqq